Get Visual Studio 2010 Beta 2

Devil May Cry 3: Special Edition

Devil May Cry 3: Special Edition

Techtree Test Labs, Aug 29, 2006 1655 hrs IST

Bloody Palace mode:
Successfully complete the game under any difficulty setting.

Dante Must Die Mode:
Successfully complete the game as Dante or Vergil under the hard difficulty setting.

Super Dante:
Successfully complete the game under the Dante Must Die difficulty setting to unlock Super Dante as a character. He has an unlimited Devil Trigger.

Vergil story mode:
Successfully complete the game under any difficulty setting.

Easy difficulty:
Intentionally fail a mission under the normal difficulty setting three to five times. A message will appear, stating that you have unlocked the easy difficulty level.

Alternately, successfully complete the game under the normal difficulty setting.

Hard difficulty:
Successfully complete the game under the normal difficulty setting.

Very hard difficulty:
Successfully complete the game under the hard difficulty setting.

Super Vergil:
Successfully complete Bloody Palace mode to unlock Super Vergil as a character. He has an unlimited Devil Trigger.

Coatless Vergi:
Complete Vergil story mode under the easy difficulty setting.

Sparda Costume (Vergil):
Successfully complete the game as Vergil under the hard difficulty setting to unlock a costume to make him appear as Sparda from the original Devil May Cry.

Alternate ending sequence:
Defeat at least 100 opponents as Dante during the ending credits.

(All fields are mandatory.)

Text Limit = 255 Characters

Type the characters you see in the picture below.

#

Characters are not case sensitive.



USER COMMENTS

Can I have a free version of the game? Thanks. If there is a cd key require to play the game, can I have it =]

by Jason, fremont, on Apr 08, 2007 11:08 AM, Report abuse   Reply

I want the cd key of Devil maycry immediately now

by Roko, Kohima, on Oct 01, 2009 06:52 PM, Report abuse

hi

by fahad, jeddah, on Sep 12, 2009 11:25 AM, Report abuse   Reply

I have purchased Devil may cry 3 (special edition), but the cd key given outside is invalid, please send me the cd key

by Pritum, Ranchi, on Aug 27, 2009 01:38 AM, Report abuse   Reply

i want mission 9 save file

by sumesh, ernakulam, on Aug 15, 2009 11:17 PM, Report abuse   Reply

it's ausam man extremmmmmmmmm

by zenul, valsad, on Mar 10, 2009 02:49 PM, Report abuse   Reply

can i get the cd key plz.........................

by rock says, jaunpur, on Aug 13, 2009 12:39 AM, Report abuse

i want the cd key of devil may cry iii special editionpls send iy to me

by dinil, thrissur, on Jul 18, 2009 08:47 PM, Report abuse   Reply

CD KEY DEVIAL MAY CRY 3 SPECIAL EDITION

by Natacha, Bom Repouso, on Mar 21, 2009 12:04 AM, Report abuse   Reply

pwede po ba makahingi ng cd key ng devil may cry 3 special edition

by Mikelito Luistr, #8 Paciano Rizal Bay Laguna, on Jul 20, 2009 04:40 PM, Report abuse

jjjjjjahahyahybahbyahybhabhabyhabyahybhaybahybuhagbyuzagvxdtzscvdxzgtxstzsxvgzxyvcgyxvcgzysfvyxgzc yxghcvyxgzcvyxcyxcyxkjiaymjakiyhauyx

by ladislav, podhorod, on Jul 08, 2009 03:09 PM, Report abuse   Reply

jjjjjjahahyahybahbyahybhabhabyhabyahybhaybahybuhagbyuzagvxdtzscvdxzgtxstzsxvgzxyvcgyxvcgzysfvyxgzc yxghcvyxgzcvyxcyxcyxkjiaymjakiyhauyx

by ladislav, podhorod, on Jul 08, 2009 03:09 PM, Report abuse   Reply

hi what is the cd key ofdevil may cry3 special edition plz send me urgently

by Nitesh, Ranchi, on Jun 27, 2009 09:05 AM, Report abuse   Reply

it's a good game

by ahmed hassan, cairo, on Jun 14, 2009 07:11 PM, Report abuse   Reply

I want cd key for devil may cry 3 special edition plz send me quickly

by manoj, punjab, on Jun 04, 2009 11:40 AM, Report abuse   Reply

gooooooood

by deepak, surat, on May 11, 2009 11:26 AM, Report abuse   Reply

no masg

by shabab, Swat, on May 09, 2009 10:51 AM, Report abuse   Reply

HERE TRY THIS>>> gu14573164572134

by nemuel ceazar, santiago city, on Apr 25, 2009 01:17 PM, Report abuse   Reply

HI

by BIPIN CHOUDHARY, UNNAO, on Apr 19, 2009 03:29 PM, Report abuse   Reply

hi

by Low Wai Ming, Malaysia, on Apr 17, 2009 10:13 PM, Report abuse   Reply

where are the saved game files on windows vista.. i just cannot see it...

by Kishan, south africa, on Apr 14, 2009 03:57 PM, Report abuse   Reply

ahmm sir ma'am i want a cd key for devil may cry 3 special edition pls past it 2 me plsss.... i want 2 play this game

by ryan, quezon city, on Apr 06, 2009 03:03 PM, Report abuse   Reply

i want cd key for devil may cry 3 special edition plz send me quickly

by matin, mumbai, on Oct 09, 2008 04:57 PM, Report abuse   Reply

CDKEY FOR DEVIL MY CRY3

by Magnus, Lindesberg, on Apr 03, 2009 03:56 PM, Report abuse

hi frinds i need devil may cry 3 cd key help me 2 find

by sundar, mumbai, on Mar 25, 2009 11:20 AM, Report abuse   Reply

this game is awsome really enjoyed the game and finished it around 3 times

by Craig, Mumbai, on Feb 27, 2009 08:38 PM, Report abuse   Reply

>gi|14456711|ref|NM_000558.3| Homo sapiens hemoglobin, alpha 1 (HBA1), mRNA ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC AAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCC TGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGG CCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTG TCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACT GCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAA GTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTGGCCATGCTT CTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAA AGTCTGAGTGGGCGGC

by santhosh, chennai, on Feb 23, 2009 08:47 AM, Report abuse   Reply

sadfsadfasdf dfasdf

by dfsadf, sdfasdfas, on Feb 14, 2009 04:10 PM, Report abuse   Reply

thanks man

by basilhs, karditsa, on Feb 02, 2009 08:25 PM, Report abuse   Reply

pe ce sait gasesc cd keyu la devil may cry 3

by tommy, oradea, on Jan 31, 2009 09:03 PM, Report abuse   Reply

I need cd key for devil may cry 3 dantes awaking pllease please may mail thanks a lot

by ARMIN, BREZA, on Jan 08, 2009 06:06 PM, Report abuse   Reply

i want cd key

by raghu, bangalore, on Jan 08, 2009 04:17 PM, Report abuse   Reply

fhgfhsgf

by ghgf, hgfhgfd, on Dec 28, 2008 05:34 PM, Report abuse   Reply

i need devil may cry 3 cd key its urgent

by vishal, ahmednagar, on Dec 27, 2008 01:52 PM, Report abuse   Reply

some there i need cd key for devil may cry 3 please send me one please...

by ralph dela cruz, quezon city, on Dec 26, 2008 11:53 AM, Report abuse   Reply

send me a cd key please i need it badly..

by ralph dela cruz, quezon city, on Dec 26, 2008 11:51 AM, Report abuse   Reply

I nead a CD -Key for davil may cry 3 special edition

by Adrijan, Sarajevo, on Nov 05, 2008 11:17 PM, Report abuse   Reply

i nead cd key for game devil may cry 3 special edition

by hamidon, brunei, on Dec 19, 2008 06:47 AM, Report abuse

download devil may cry

by duc, da lat city, on Apr 10, 2008 11:02 PM, Report abuse   Reply

esrs asd s ertdfs

by akash, nagpur, on Dec 18, 2008 10:33 AM, Report abuse

yuawstdhagsda dnbujashdkj m,asdnbzjxyuawsmdmasyxdcb nasd

by akash, nagpur, on Dec 18, 2008 10:31 AM, Report abuse   Reply

by Anonymous, , on Dec 18, 2008 02:13 AM, Report abuse   Reply

MY GAME

by DMADHV, RAJKOT, on Dec 11, 2008 12:25 PM, Report abuse   Reply

can you send me the cd key of devil may cry 3 special editons please i need badly.......=( i cant play devil may cry that i like a most >.<'

by kent, davao, on Dec 11, 2008 07:54 AM, Report abuse   Reply

kjksgauydgsgcdvljwthwebduysagas ghgx

by prasannabaishya, barpetaroad, on Dec 08, 2008 01:01 PM, Report abuse   Reply

DMC bestest game ever

by petar, Sliven, on Dec 06, 2008 09:28 PM, Report abuse   Reply

very good

by bololo, ps, on Nov 27, 2008 09:35 PM, Report abuse   Reply

Hi! Please could you send me a CD-Key for Devil May Cry 3 Special Edition fast.

by Johnny Storm, Kerala, on Nov 19, 2008 02:39 PM, Report abuse   Reply

hi my name is khalid and i hope this site can give me the premetion to download devil may cry 3

by khalid, egypt, on Oct 30, 2008 01:11 AM, Report abuse   Reply

ano po ung cd key ng devil may cry 3 sa pc ???

by Jehrees, Batangas, on Oct 22, 2008 04:13 PM, Report abuse   Reply

Good

by Michael, New York, on Oct 21, 2008 11:05 PM, Report abuse   Reply

devil may cry 3 cd key... du67120631759495

by G@z@, Bangaluru, on Sep 15, 2008 01:12 AM, Report abuse   Reply

thnxx G@z@

by Abhijeet, Delhi, on Oct 18, 2008 08:09 PM, Report abuse

thx i need this

by islam, mansoura, on Oct 10, 2008 02:22 PM, Report abuse   Reply

can you give me serial key of devil may cry3 special edition

by shubhankar arya, bareilly, on Sep 21, 2008 10:56 PM, Report abuse   Reply

hai..frens...i cant play Rainbow vegas SIX 2,,it s go outta f frequency....m havin geforce 7300,can any1 help

by G@Z@, bengaluru, on Sep 15, 2008 01:20 AM, Report abuse   Reply

hai

by kavitha, chennai, on Sep 12, 2008 04:54 PM, Report abuse   Reply

hi friends i have Devil May Cry 3: Special Edition D.V.D but i have not CD KEY plz give me CD KEY

by samir, gujarat, on Sep 09, 2008 10:37 AM, Report abuse   Reply

cd key

by daxesh, ahmedabad, on Sep 08, 2008 07:38 PM, Report abuse   Reply

hey i want to cd-key of Devil May Cry 3 fast

by daxesh, ahmedabad, on Sep 08, 2008 07:36 PM, Report abuse   Reply

its great

by priyanka, noida, on Dec 19, 2007 05:33 PM, Report abuse   Reply

where i get the cheats

by ajit, c.h.d, on Aug 30, 2008 05:39 PM, Report abuse

some body help me i am searching for cd key of devil may cry 3....please help me

by chernouha othma, boumerdes-baghlia-ouled hmida, on Aug 27, 2008 11:09 PM, Report abuse   Reply

thank you very much for cd key

by hellraiser, manhattan, on Aug 19, 2008 05:31 PM, Report abuse   Reply

HAY MY NAME IS ENIS FROM BOSNIA AND HERCEGOVINA MOZES MI RECI STA TREBA POSLIJE INSTALACIJE IGRE PLEASEEEEE

by ENIS.GOLAC, GRADACAC, on Aug 25, 2008 02:57 PM, Report abuse

MOZETEL MI RECI STA TREBA POSLIJE INSTALACIJE IGRE

by ENIS.GOLAC, GRADACAC, on Aug 25, 2008 02:52 PM, Report abuse   Reply

nice

by ramu, hyderabad, on Aug 22, 2008 07:51 PM, Report abuse   Reply

PC - Devil May Cry 3 Special Edition cd-key

by ashik, pune, on Aug 13, 2008 03:58 PM, Report abuse   Reply

what is the cheat codes for PS 2 version

by kishore, chennai, on Aug 12, 2008 06:24 PM, Report abuse   Reply

thx god wow

by kum, phimai, on Aug 07, 2008 04:21 PM, Report abuse   Reply

haiiiii

by sareeshkumar.k, nileswar, on Aug 05, 2008 12:19 PM, Report abuse   Reply

hii

by Akash, delhi, on Aug 04, 2008 04:25 PM, Report abuse   Reply

Cheats

by Devil May Cry 3, Innsbruck, on Jul 29, 2008 11:17 AM, Report abuse   Reply

cool game very interesting to play

by Micky Singh, Delhi, on Jul 22, 2008 07:58 AM, Report abuse   Reply

game

by abhishek, maharashtra, on Jul 19, 2008 01:02 PM, Report abuse   Reply

Hi I want to download this game Devil May Cry 3

by mudasir khan, bangalore, on Jul 08, 2008 11:25 AM, Report abuse   Reply

good

by ashok, sarkaghat, on Jul 06, 2008 06:06 PM, Report abuse   Reply

cant play devil may cry on my latest sony VAIO vista home edition ,pls someone help me

by jery, abuja, on Jun 27, 2008 04:55 PM, Report abuse   Reply

good

by Sandeep, Bahthinda, on Jun 18, 2008 06:59 PM, Report abuse   Reply

hi ..........how r u friends

by arun, chennai, on Jun 16, 2008 09:04 AM, Report abuse   Reply

nothing

by sreelatha, bangalore, on Jun 09, 2008 03:01 PM, Report abuse   Reply

Nice...Try It !!

by chakrapani, Hyderabad, on Jun 01, 2008 12:39 PM, Report abuse   Reply

Ok

by Sandip, Kolkata, on May 31, 2008 09:10 PM, Report abuse   Reply

hi

by ranjith, chennai, on May 21, 2008 12:58 PM, Report abuse   Reply

nice game

by pravin, maharashtra, on May 03, 2008 10:42 AM, Report abuse   Reply

good

by pavan, pune, on Apr 29, 2008 09:34 AM, Report abuse   Reply

masud_dady fhsdsefjkhdfkifsef

by masud, masud, on Apr 27, 2008 03:49 PM, Report abuse   Reply

Nice Game

by krishnasagar, Visakhapatnam, on Apr 21, 2008 02:40 PM, Report abuse   Reply

hi

by Anonymous, iraq, on Apr 19, 2008 10:54 PM, Report abuse   Reply

drdrtetetet

by cobra, varazdin, on Apr 15, 2008 05:36 PM, Report abuse   Reply

Can you please tell me where I can get the Devil May Cry 3 crack from

by meme, Port Elizabeth, on Apr 13, 2008 06:33 AM, Report abuse   Reply

hi i am student

by aadil, riyadh, on Apr 05, 2008 05:28 PM, Report abuse   Reply

..............................................................

by aadil, riyadh, on Apr 05, 2008 05:25 PM, Report abuse   Reply

hiiiiiiiiiiiiiiiiiiiiiiii

by amoa, pune, on Mar 29, 2008 12:26 AM, Report abuse   Reply

HIIIIIII

by amoa, pune, on Mar 29, 2008 12:20 AM, Report abuse   Reply

where

by azz, cairo, on Mar 27, 2008 12:06 AM, Report abuse   Reply

thanks

by azz, cairo, on Mar 27, 2008 12:02 AM, Report abuse   Reply

PC - Devil May Cry 3 Special Edition cd-key

by Adam, polska, on Mar 24, 2008 04:32 PM, Report abuse   Reply

plz sent this game for me

by Rashid, raipur, on Mar 21, 2008 10:37 PM, Report abuse   Reply

good...

by saten, mustvee, on Mar 20, 2008 01:57 PM, Report abuse   Reply

i like this game

by Danna, Kuching, on Mar 18, 2008 12:28 PM, Report abuse   Reply

new software

by ajay, mumbai, on Mar 10, 2008 12:26 PM, Report abuse   Reply

sd key for devil may cry 3 special eddition for pc is du67120633738128

by kapil jain, indore, on Mar 08, 2008 04:31 PM, Report abuse   Reply

cd key for devil may cry3 special edition for pc

by meet choudhary, indore, on Mar 06, 2008 03:09 AM, Report abuse   Reply

nice game

by jazy, new delhi, on Mar 05, 2008 05:36 PM, Report abuse   Reply

suppqr

by sree, hydarabad, on Mar 03, 2008 10:56 AM, Report abuse   Reply

i like it

by girish makawana, ahmedabad, on Feb 19, 2008 08:33 PM, Report abuse   Reply

its cute

by palanikumar, madurai, on Feb 18, 2008 05:44 PM, Report abuse   Reply

any time game

by sameerjain, delhi, on Feb 16, 2008 09:21 AM, Report abuse   Reply

please send game for me

by mmmm, tehran, on Feb 13, 2008 03:40 AM, Report abuse   Reply

sysysysy

by sysys, sysys, on Jan 23, 2008 08:46 AM, Report abuse   Reply

foarte tare jocul

by dani, bucuresti, on Jan 18, 2008 03:53 PM, Report abuse   Reply

so? wow!

by vondash, maynila, on Jan 13, 2008 03:38 PM, Report abuse   Reply

aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

by sherif, alex, on Jan 08, 2008 02:14 AM, Report abuse   Reply

i want to be able to play your games becose now i have registered

by godspower, warri, on Dec 30, 2007 10:19 PM, Report abuse   Reply

i will kill for this game. where can i download pls

by locknum, cape town, on Dec 30, 2007 03:39 AM, Report abuse   Reply

am enjoying your adverts if possible i want to get connected.

by chatramada Nath, nigeria, on Dec 18, 2007 06:08 PM, Report abuse   Reply

this is verey best

by rajeev, bajbur, on Dec 17, 2007 10:44 AM, Report abuse   Reply

it"s really a very good game

by altayb, khartoum, on Dec 15, 2007 04:42 AM, Report abuse   Reply

nice game

by Anonymous, delhi, on Dec 09, 2007 06:19 PM, Report abuse   Reply

kkoi

by kumar, madura, on Dec 05, 2007 12:24 PM, Report abuse   Reply

HI WHAT IS YOUER NAME

by NAVEEN, INDIA, on Dec 03, 2007 05:27 PM, Report abuse   Reply

i need cd key plz,,,

by joanne, calamba, on Dec 03, 2007 03:49 PM, Report abuse   Reply

very good games

by ritu, varanasi, on Dec 01, 2007 07:20 PM, Report abuse   Reply

e tare jocul

by bucgi, bucuresti, on Nov 26, 2007 02:04 AM, Report abuse   Reply

this game is the most power full game and its rock yeah its super

by yazan, amman, on Sep 03, 2007 09:02 PM, Report abuse   Reply

faaaaaaaaaa

by arvind jora, delhi, on Nov 22, 2007 10:24 PM, Report abuse

fsadf

by mohammed asif i, hyderabad, on Nov 11, 2007 12:09 PM, Report abuse   Reply

provide me PC CD Keys of DEvil may cry 3 special Edition plz

by ashutosh, berhampur, on Nov 08, 2007 09:02 AM, Report abuse   Reply

fhhkmhm,nbf

by fgfmhjkyuk, fefhjh, on Nov 04, 2007 03:53 PM, Report abuse   Reply

so agradecimentos!!!

by vital joaquim, sao paulo, on Nov 04, 2007 01:09 AM, Report abuse   Reply

its really good

by parthasarathi p, bangalore, on Oct 24, 2007 08:36 AM, Report abuse   Reply

i like dis site.

by Shreya, Chennai, on Oct 14, 2007 09:16 AM, Report abuse   Reply

hi I m the Don.

by manoj, delhi, on Oct 11, 2007 02:42 PM, Report abuse   Reply

nice game

by shyamraj bhat, pune, on Oct 08, 2007 10:24 AM, Report abuse   Reply

good

by daneil, new york, on Sep 30, 2007 10:25 PM, Report abuse   Reply

thanksfor providing the free games

by somnath behera, cuttack, on Dec 14, 2006 11:15 AM, Report abuse   Reply

I want games of nokia 5200

by jatin, rohini, on Jul 07, 2007 12:53 PM, Report abuse

i love you all

by bijay agarwal, cuttack, on Sep 28, 2007 08:19 PM, Report abuse

I like to play games .It makes me to relakes

by Rinu, Chennai, on Sep 26, 2007 05:17 AM, Report abuse   Reply

good

by vijay, pune, on Sep 22, 2007 10:16 AM, Report abuse   Reply

no

by tushar, pune, on Sep 20, 2007 10:32 AM, Report abuse   Reply

this game is the best game

by john, grand-baie, on Sep 19, 2007 12:39 AM, Report abuse   Reply

how could i download this game

by sachin, chandigarh, on Sep 14, 2007 11:10 AM, Report abuse   Reply

i want to download devil may cry

by sa7tout, tetuan, on Sep 13, 2007 11:34 PM, Report abuse   Reply

ok

by bvchinna, rajahmundry, on Sep 03, 2007 08:20 PM, Report abuse   Reply

yase

by shad, iraq, on Aug 31, 2007 02:32 AM, Report abuse   Reply

esam

by esam, cairo, on Aug 30, 2007 03:28 AM, Report abuse   Reply

cao

by Marinko, Zrenjanin, on Aug 29, 2007 06:14 PM, Report abuse   Reply

i need free java games in w810i model

by m.ramachnadran, chennai, on Aug 28, 2007 03:20 PM, Report abuse   Reply

good

by gagan, Chandigarh, on Aug 27, 2007 06:32 PM, Report abuse   Reply

CD-key

by alen, zenica, on Aug 20, 2007 06:27 PM, Report abuse   Reply

good game

by kariss, rabat, on Aug 20, 2007 02:07 AM, Report abuse   Reply

iffffffffffff

by mohammed, egypt, on Aug 17, 2007 01:55 PM, Report abuse   Reply

I want to play it

by sagar, delhi, on Aug 17, 2007 11:42 AM, Report abuse   Reply

send the project igi games

by bharath, chennai, on Dec 08, 2006 04:10 PM, Report abuse   Reply

Please give me the cheats of project IGI

by Amrit, Bhubaneswar, on Aug 12, 2007 02:47 PM, Report abuse

good`

by anit, noida, on Aug 10, 2007 07:06 PM, Report abuse   Reply

game is super

by sharad, pune, on Aug 08, 2007 09:03 AM, Report abuse   Reply

game is super

by andrzejek, mielec, on Aug 03, 2007 02:06 AM, Report abuse   Reply

my opinion is very good. nothing is in my mind. thanku.

by sabari raj, trivandrum, on Aug 02, 2007 03:19 PM, Report abuse   Reply

will ths game work on windows vista

by kaushik, bangalore, on Jul 31, 2007 07:56 PM, Report abuse   Reply

game download

by Shivkumar, noida, on Jul 31, 2007 10:07 AM, Report abuse   Reply

asdasd

by rober, rg, on Jul 30, 2007 05:23 AM, Report abuse   Reply

hello sir what is this plz explan me

by aijaz, hyderabad, on Jul 24, 2007 03:31 PM, Report abuse   Reply

provide me PC CD Keys of DEvil may cry 3 special Edition

by arshad, mumbai-India, on Jul 23, 2007 08:10 AM, Report abuse   Reply

i want the game cd keys list.

by Aftab shaikh, ambernath (mumbai), on Jul 22, 2007 05:30 PM, Report abuse   Reply

game

by viji, coimbatore, on Jan 07, 2007 06:23 AM, Report abuse   Reply

vjgugjgjghjghijujghjghjgjhj

by tridip, delhi, on Jul 14, 2007 01:08 PM, Report abuse

good

by Benzsample, thailand, on Jul 13, 2007 08:36 AM, Report abuse   Reply

Thank

by Benzsample, thaiload, on Jul 13, 2007 08:32 AM, Report abuse   Reply

good

by raj rio, hisar, on Jul 07, 2007 08:42 AM, Report abuse   Reply

l

by subhash, mumbai, on Jul 06, 2007 05:59 PM, Report abuse   Reply

1,barasakthi nagar,kvp,TN

by ganesh kumar, kvp, on Jul 06, 2007 02:40 PM, Report abuse   Reply

i love game

by tridal, bharuch, on Jul 05, 2007 01:15 PM, Report abuse   Reply

can i have the devil may cry thin demo

by damon, timins, on Jul 04, 2007 04:57 AM, Report abuse   Reply

were do u download it!!!!!

by damon, timins, on Jul 04, 2007 04:55 AM, Report abuse   Reply

very good

by mukesh, delhi, on Jul 02, 2007 05:04 PM, Report abuse   Reply

i like and want to play devil may cry 3

by manav, rampur, on Jun 30, 2007 12:38 PM, Report abuse   Reply

i want to play devil may cry 3

by manav, rampur, on Jun 30, 2007 12:34 PM, Report abuse   Reply

sdfasdf

by Pentax, dalat, on Jun 28, 2007 09:30 PM, Report abuse   Reply

please i want to play this game and i want it cd key

by yugo, lagos, on Jun 27, 2007 01:39 AM, Report abuse   Reply

free games

by prem, pune, on Jun 23, 2007 04:01 PM, Report abuse   Reply

i need cd key

by nemanja, belgrade, on Jun 20, 2007 08:56 PM, Report abuse   Reply

free games

by lucky, india, on Jun 18, 2007 02:56 PM, Report abuse   Reply

by emma, london, on Jun 17, 2007 07:22 PM, Report abuse   Reply

dasdasd

by dasdasd, dasdasd, on Jun 16, 2007 08:56 PM, Report abuse   Reply

games

by siergejus, cork, on Jun 16, 2007 04:50 PM, Report abuse   Reply

sfdfsf

by anuj, allahabad, on Jun 15, 2007 06:34 PM, Report abuse   Reply

very nice game

by maruti naik, mumbai, on Jun 12, 2007 07:54 PM, Report abuse   Reply

hi

by chandu, mumbai, on Jun 09, 2007 03:59 PM, Report abuse   Reply

i want to play this game

by sumit, delhi, on Dec 16, 2006 05:29 PM, Report abuse   Reply

i want download this game with its cd key please do that for me

by asif khan, PUNE, on Jun 07, 2007 01:55 PM, Report abuse

best profil

by rizwan, mumbai, on Jun 06, 2007 08:43 PM, Report abuse   Reply

hello

by mohammed, hyd, on Jun 04, 2007 08:19 PM, Report abuse   Reply

by Anonymous, , on Jun 04, 2007 04:39 PM, Report abuse   Reply

SDFGDSFG

by Anonymous, rajkot, on Jun 03, 2007 11:57 PM, Report abuse   Reply

good

by lili, delhi, on May 29, 2007 12:45 AM, Report abuse   Reply

good

by sumit, kanpur, on May 28, 2007 01:12 PM, Report abuse   Reply

rtjaruhjetjaz

by rehRHWRH, ERHrh, on May 27, 2007 07:34 PM, Report abuse   Reply

I WANT GOOD GAME

by NAGARAJ, BANGALORE, on May 23, 2007 06:02 PM, Report abuse   Reply

i like to download this game

by arun kumar, chennai, on May 23, 2007 04:23 PM, Report abuse   Reply

NOOOOOOOOOOOOOOOOOOOOOOO

by Anonymous, THORNTON CO, on May 18, 2007 10:23 PM, Report abuse   Reply

dfs

by sdfds, sdfsd, on May 10, 2007 11:57 PM, Report abuse   Reply

nice

by hari, coimbatore, on May 07, 2007 11:58 AM, Report abuse   Reply

nothin

by manu, bangalore, on May 06, 2007 08:41 AM, Report abuse   Reply

i like it

by vishnath pandit, delhi, on May 05, 2007 05:53 PM, Report abuse   Reply

its goods game

by vishnath, delhi, on May 05, 2007 05:51 PM, Report abuse   Reply

how are you

by yash, delhi, on May 05, 2007 05:50 PM, Report abuse   Reply

very hot game

by akram, cairo, on May 05, 2007 12:52 AM, Report abuse   Reply

I Love Games

by Bhavesh, Porbandar, on May 04, 2007 08:33 PM, Report abuse   Reply

thanks

by anand, delhi, on May 04, 2007 08:22 PM, Report abuse   Reply

good

by mukesh, delhi, on Apr 30, 2007 05:29 PM, Report abuse   Reply

cd key is du67120631759495

by deandb, Dobrich, on Apr 29, 2007 02:45 PM, Report abuse   Reply

i love games action

by dinesh, ludhiana, on Apr 25, 2007 03:12 PM, Report abuse   Reply

iyhuiiuitgiouou

by guyfuig, huohoh, on Apr 23, 2007 01:31 PM, Report abuse   Reply

i want to play cricket

by ashish, pune, on Apr 22, 2007 05:28 PM, Report abuse   Reply

this site is too good

by hyder, gurgaon, on Apr 13, 2007 01:59 PM, Report abuse   Reply

Please download this game.

by tamal biswas, kolkata, on Apr 02, 2007 01:00 PM, Report abuse   Reply

mALKSJLKAJSDLKASDLK

by MASOUD, GONBAD, on Apr 12, 2007 12:25 AM, Report abuse

vai tomar no cuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu

by lucas kleaim, BAIXO GUADU, on Apr 11, 2007 06:23 PM, Report abuse   Reply

pls cd key!!!

by joca, subotica, on Apr 08, 2007 10:34 PM, Report abuse   Reply

can i get a cd key plssss

by nhed, manila, on Apr 05, 2007 03:29 PM, Report abuse   Reply

ewtewte5tre6t

by 54546, 45y4, on Apr 04, 2007 04:56 PM, Report abuse   Reply

i m pra_pri

by pra_pri, ahmedabad, on Apr 04, 2007 12:07 AM, Report abuse   Reply

give me good plan

by pra_pri, ahmedabad, on Apr 04, 2007 12:10 AM, Report abuse

i have been w8ng for this game goto to go and check out this version

by subbu, bangalore, on Apr 03, 2007 04:47 PM, Report abuse   Reply

good one

by Hanther, India, on Mar 30, 2007 08:30 PM, Report abuse   Reply

ok good

by kishore kumar, vizag, on Jan 13, 2007 07:27 PM, Report abuse   Reply

you have the cd key of devil me cry

by Sheila, Iligan, on Mar 27, 2007 07:43 AM, Report abuse

i need cd key of devil me cry pls send me....

by Sheila, Iligan, on Mar 27, 2007 07:41 AM, Report abuse   Reply

I need athe cd key, anybody can help me?

by Sheila, Phil, on Mar 24, 2007 01:36 PM, Report abuse   Reply

best

by harry, kurukshetra, on Mar 24, 2007 09:55 AM, Report abuse   Reply

can i download devil may cry 3 to pc (free) give me the link pls.

by s0nny_2oo4, tembilahan, on Mar 21, 2007 09:28 AM, Report abuse   Reply

i want cd key for this game?

by prabodh, kolkata, india, on Jan 21, 2007 02:10 PM, Report abuse   Reply

ere

by sam, tyty, on Mar 20, 2007 06:05 PM, Report abuse

by Anonymous, , on Mar 11, 2007 08:52 PM, Report abuse   Reply

333333333333

by dfer, kochi, on Mar 10, 2007 11:56 AM, Report abuse   Reply

wow!

by vinod, mumbai, on Feb 27, 2007 07:18 PM, Report abuse   Reply

i like action game

by mayur, mumbai, on Feb 25, 2007 03:49 PM, Report abuse   Reply

cool game 0

by anonymous, anonymous, on Feb 23, 2007 08:52 PM, Report abuse   Reply

I WANT TO JAION IT.

by ROCKY, RANCHI, on Feb 21, 2007 06:57 PM, Report abuse   Reply

If you wish to notify the moderator that this particular message contains spam or other offensive content, simply hit the "Submit" button (there is no need to enter a comment). If you wish to make a comment about this post to the moderator, then feel free to enter something into the comment field below.

by bhupendra, mpdinagar, on Feb 21, 2007 08:30 AM, Report abuse   Reply

fsdf

by dfsdf, sdfsdf, on Feb 15, 2007 08:49 PM, Report abuse   Reply

If you wish to notify the moderator that this particular message contains spam or other offensive content, simply hit the "Submit" button (there is no need to enter a comment). If you wish to make a comment about this post to the moderator, then feel free to enter something into the comment field below.

by sandeep, surat, on Feb 15, 2007 11:50 AM, Report abuse   Reply

iran

by mohsen, boshehr, on Feb 10, 2007 01:16 AM, Report abuse   Reply

uses

by syed, channai, on Feb 02, 2007 06:05 PM, Report abuse   Reply

game is supper

by syed, channai, on Feb 02, 2007 06:00 PM, Report abuse   Reply

game is not working

by shivam jalkote, amravati, on Feb 01, 2007 06:31 PM, Report abuse   Reply

I NEVER BEEN PLAYED IT. SO I CANT TO TELL ABOUT THIS GAME. IF YOU PROVIDE ME A DEMO VERSION THEN I CAN GIVE MY OPENION.

by Kalyan Mazumder, Kolkata, on Sep 06, 2006 01:23 AM, Report abuse   Reply

i want to play a demo version,and then i can give my openion.

by abhimannyu, Chennai, on Jan 21, 2007 08:14 PM, Report abuse

people i really need the cd key for this game!

by angie, buenos aires, on Jan 20, 2007 05:24 AM, Report abuse   Reply

i need a cd-key pleaseeeee now please

by george, haskovo, on Jan 20, 2007 04:26 AM, Report abuse   Reply

send this cd by mail

by gunashekar, bangalore, on Jan 17, 2007 10:45 AM, Report abuse   Reply

i need a cd key for this game please!

by kyle, red deer, on Jan 10, 2007 05:09 AM, Report abuse   Reply

best

by AHSANKHAN, HYDERABAD, on Jan 09, 2007 01:56 PM, Report abuse   Reply

Hi ! ! !

by Sandeep kumar, Panchkula, on Jan 08, 2007 02:53 PM, Report abuse   Reply

WHERE IS THE GAME TO PLAY?

by KUMARA, CHENNAI, on Jan 08, 2007 12:32 AM, Report abuse   Reply

all cheats

by ngbf, bnvnmb, on Jan 07, 2007 12:39 PM, Report abuse   Reply

I want the save game for my pc adn the cheats.

by khashayar, tehran, on Jan 07, 2007 07:42 PM, Report abuse

Hello ! ! !

by Ashok kumar, Punchkula, on Jan 06, 2007 03:37 PM, Report abuse   Reply

by taran, nagpur, on Jan 05, 2007 08:22 PM, Report abuse   Reply

why u are not downloading those games to us.

by bereket, OROMIYA, on Jan 01, 2007 02:03 PM, Report abuse   Reply

hiiiiiiiiiiiiiiiii

by kabir, mumbai, on Jan 01, 2007 01:07 PM, Report abuse   Reply

good one

by ramesh, bangalore, on Dec 28, 2006 06:25 PM, Report abuse   Reply

yes

by jayant, new delhi, on Dec 23, 2006 12:23 PM, Report abuse   Reply

downloding game is it

by kunal, bombay, on Dec 20, 2006 09:35 AM, Report abuse   Reply

as

by gurdeep, jammu, on Dec 16, 2006 04:47 PM, Report abuse   Reply

hi guys..........

by sivakumar, chennai, on Dec 14, 2006 04:12 PM, Report abuse   Reply

by sivakumar, chennai, on Dec 14, 2006 04:11 PM, Report abuse   Reply

i want it

by aijaz, hyderabad, on Dec 11, 2006 01:09 PM, Report abuse   Reply

frst of all play demo i sure u will go for it for full

by shaky_143, Ludhiana, on Dec 08, 2006 04:21 PM, Report abuse   Reply

send the games to me

by bharath, chennai, on Dec 08, 2006 04:08 PM, Report abuse   Reply

I wabnt to play this game

by Bhanu Pratap Si, Delhi, on Dec 04, 2006 01:17 PM, Report abuse   Reply

its pretty fun ive beaten it on hardnormal ndcurently working on very hard mode with sparde costume as sonte

by devilmaycrybomn, graham, on Dec 05, 2006 11:26 PM, Report abuse

Amazing, I like too much.

by Vjy, Ahmedabad / India, on Dec 05, 2006 10:44 AM, Report abuse   Reply

sexy game

by bereket, Haramaya University(Oromia), on Nov 13, 2006 01:03 PM, Report abuse   Reply

have u palyed this game

by Bhanu Pratap Si, Delhi, on Dec 04, 2006 01:19 PM, Report abuse

please i want to play game

by KULDEEP, NOIDA, on Dec 04, 2006 10:50 AM, Report abuse   Reply

wow

by harry, chandigarh, on Dec 03, 2006 12:50 PM, Report abuse   Reply

I WANT GAME

by SWAPNIL, MUMBAI, on Nov 09, 2006 10:36 AM, Report abuse   Reply

verynice game

by avdhesh, delhi, on Nov 02, 2006 10:54 PM, Report abuse   Reply

hi ehelo

by naveen, hyderabad, on Nov 02, 2006 08:16 PM, Report abuse   Reply

Iam interest to play games

by R.S.priya, madurai, on Oct 30, 2006 11:57 PM, Report abuse   Reply

thank you

by ahmed, cairo, on Oct 10, 2006 09:34 PM, Report abuse   Reply

NICE KEEP ITUP

by RAJA, COIMBATORE, on Oct 10, 2006 06:46 PM, Report abuse   Reply

i n?

by Giang, Hanoi, on Oct 06, 2006 03:02 PM, Report abuse   Reply

By Aleem Abu Dhabi

by aleempasha, Bangalore, on Sep 03, 2006 06:57 PM, Report abuse   Reply

hello

by guna, chennai, on Sep 21, 2006 08:33 PM, Report abuse

by SHANTALING, BANGALORE, on Sep 03, 2006 10:33 PM, Report abuse   Reply

stupid

by guna, chennai, on Sep 21, 2006 08:32 PM, Report abuse

power game

by parveen verma, kaithal, on Sep 11, 2006 10:39 PM, Report abuse   Reply

hai

by guna, chennai, on Sep 21, 2006 08:31 PM, Report abuse

GOOD GAME

by karthik, chennai, on Sep 18, 2006 09:12 AM, Report abuse   Reply

loose

by guna, chennai, on Sep 21, 2006 08:29 PM, Report abuse

Can u send me a game of 'JONE OF ARC"

by Sam, Mum, on Sep 03, 2006 11:46 PM, Report abuse   Reply

Thanks for providing free games

by aleempasha, Bangalore, on Sep 03, 2006 06:56 PM, Report abuse   Reply

hello sir

by kumar, landan, on Sep 02, 2006 02:01 PM, Report abuse   Reply

hi

by nikhil, mumbai, on Sep 02, 2006 12:40 PM, Report abuse   Reply

HOT STUFF