Devil May Cry 3: Special Edition
Techtree Test Labs, Aug 29, 2006 1655 hrs IST
-
The Best of :
- Mobiles
- Laptops
- MP3 Players
- Digital Cameras
- Games
- Downloads
- Mobile Downloads
Bloody Palace mode:
Successfully complete the game under any difficulty setting.
Dante Must Die Mode:
Successfully complete the game as Dante or Vergil under the hard difficulty setting.
Super Dante:
Successfully complete the game under the Dante Must Die difficulty setting to unlock Super Dante as a character. He has an unlimited Devil Trigger.
Vergil story mode:
Successfully complete the game under any difficulty setting.
Easy difficulty:
Intentionally fail a mission under the normal difficulty setting three to five times. A message will appear, stating that you have unlocked the easy difficulty level.
Alternately, successfully complete the game under the normal difficulty setting.
Hard difficulty:
Successfully complete the game under the normal difficulty setting.
Very hard difficulty:
Successfully complete the game under the hard difficulty setting.
Super Vergil:
Successfully complete Bloody Palace mode to unlock Super Vergil as a character. He has an unlimited Devil Trigger.
Coatless Vergi:
Complete Vergil story mode under the easy difficulty setting.
Sparda Costume (Vergil):
Successfully complete the game as Vergil under the hard difficulty setting to unlock a costume to make him appear as Sparda from the original Devil May Cry.
Alternate ending sequence:
Defeat at least 100 opponents as Dante during the ending credits.
USER COMMENTS
I want the cd key of Devil maycry immediately now
by Roko, Kohima, on Oct 01, 2009 06:52 PM, Report abuse
by fahad, jeddah, on Sep 12, 2009 11:25 AM, Report abuse Reply
I have purchased Devil may cry 3 (special edition), but the cd key given outside is invalid, please send me the cd key
by Pritum, Ranchi, on Aug 27, 2009 01:38 AM, Report abuse Reply
by sumesh, ernakulam, on Aug 15, 2009 11:17 PM, Report abuse Reply
by zenul, valsad, on Mar 10, 2009 02:49 PM, Report abuse Reply
can i get the cd key plz.........................
by rock says, jaunpur, on Aug 13, 2009 12:39 AM, Report abuse
i want the cd key of devil may cry iii special editionpls send iy to me
by dinil, thrissur, on Jul 18, 2009 08:47 PM, Report abuse Reply
CD KEY DEVIAL MAY CRY 3 SPECIAL EDITION
by Natacha, Bom Repouso, on Mar 21, 2009 12:04 AM, Report abuse Reply
pwede po ba makahingi ng cd key ng devil may cry 3 special edition
by Mikelito Luistr, #8 Paciano Rizal Bay Laguna, on Jul 20, 2009 04:40 PM, Report abuse
jjjjjjahahyahybahbyahybhabhabyhabyahybhaybahybuhagbyuzagvxdtzscvdxzgtxstzsxvgzxyvcgyxvcgzysfvyxgzc yxghcvyxgzcvyxcyxcyxkjiaymjakiyhauyx
by ladislav, podhorod, on Jul 08, 2009 03:09 PM, Report abuse Reply
jjjjjjahahyahybahbyahybhabhabyhabyahybhaybahybuhagbyuzagvxdtzscvdxzgtxstzsxvgzxyvcgyxvcgzysfvyxgzc yxghcvyxgzcvyxcyxcyxkjiaymjakiyhauyx
by ladislav, podhorod, on Jul 08, 2009 03:09 PM, Report abuse Reply
hi what is the cd key ofdevil may cry3 special edition plz send me urgently
by Nitesh, Ranchi, on Jun 27, 2009 09:05 AM, Report abuse Reply
by ahmed hassan, cairo, on Jun 14, 2009 07:11 PM, Report abuse Reply
I want cd key for devil may cry 3 special edition plz send me quickly
by manoj, punjab, on Jun 04, 2009 11:40 AM, Report abuse Reply
by deepak, surat, on May 11, 2009 11:26 AM, Report abuse Reply
by shabab, Swat, on May 09, 2009 10:51 AM, Report abuse Reply
HERE TRY THIS>>> gu14573164572134
by nemuel ceazar, santiago city, on Apr 25, 2009 01:17 PM, Report abuse Reply
by BIPIN CHOUDHARY, UNNAO, on Apr 19, 2009 03:29 PM, Report abuse Reply
by Low Wai Ming, Malaysia, on Apr 17, 2009 10:13 PM, Report abuse Reply
where are the saved game files on windows vista.. i just cannot see it...
by Kishan, south africa, on Apr 14, 2009 03:57 PM, Report abuse Reply
ahmm sir ma'am i want a cd key for devil may cry 3 special edition pls past it 2 me plsss.... i want 2 play this game
by ryan, quezon city, on Apr 06, 2009 03:03 PM, Report abuse Reply
i want cd key for devil may cry 3 special edition plz send me quickly
by matin, mumbai, on Oct 09, 2008 04:57 PM, Report abuse Reply
by Magnus, Lindesberg, on Apr 03, 2009 03:56 PM, Report abuse
hi frinds i need devil may cry 3 cd key help me 2 find
by sundar, mumbai, on Mar 25, 2009 11:20 AM, Report abuse Reply
this game is awsome really enjoyed the game and finished it around 3 times
by Craig, Mumbai, on Feb 27, 2009 08:38 PM, Report abuse Reply
>gi|14456711|ref|NM_000558.3| Homo sapiens hemoglobin, alpha 1 (HBA1), mRNA ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC AAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCC TGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGG CCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTG TCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACT GCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAA GTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTGGCCATGCTT CTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAA AGTCTGAGTGGGCGGC
by santhosh, chennai, on Feb 23, 2009 08:47 AM, Report abuse Reply
by dfsadf, sdfasdfas, on Feb 14, 2009 04:10 PM, Report abuse Reply
by basilhs, karditsa, on Feb 02, 2009 08:25 PM, Report abuse Reply
pe ce sait gasesc cd keyu la devil may cry 3
by tommy, oradea, on Jan 31, 2009 09:03 PM, Report abuse Reply
I need cd key for devil may cry 3 dantes awaking pllease please may mail thanks a lot
by ARMIN, BREZA, on Jan 08, 2009 06:06 PM, Report abuse Reply
by raghu, bangalore, on Jan 08, 2009 04:17 PM, Report abuse Reply
by ghgf, hgfhgfd, on Dec 28, 2008 05:34 PM, Report abuse Reply
i need devil may cry 3 cd key its urgent
by vishal, ahmednagar, on Dec 27, 2008 01:52 PM, Report abuse Reply
some there i need cd key for devil may cry 3 please send me one please...
by ralph dela cruz, quezon city, on Dec 26, 2008 11:53 AM, Report abuse Reply
send me a cd key please i need it badly..
by ralph dela cruz, quezon city, on Dec 26, 2008 11:51 AM, Report abuse Reply
I nead a CD -Key for davil may cry 3 special edition
by Adrijan, Sarajevo, on Nov 05, 2008 11:17 PM, Report abuse Reply
i nead cd key for game devil may cry 3 special edition
by hamidon, brunei, on Dec 19, 2008 06:47 AM, Report abuse
by duc, da lat city, on Apr 10, 2008 11:02 PM, Report abuse Reply
by akash, nagpur, on Dec 18, 2008 10:33 AM, Report abuse
yuawstdhagsda dnbujashdkj m,asdnbzjxyuawsmdmasyxdcb nasd
by akash, nagpur, on Dec 18, 2008 10:31 AM, Report abuse Reply
by Anonymous, , on Dec 18, 2008 02:13 AM, Report abuse Reply
by DMADHV, RAJKOT, on Dec 11, 2008 12:25 PM, Report abuse Reply
can you send me the cd key of devil may cry 3 special editons please i need badly.......=( i cant play devil may cry that i like a most >.<'
by kent, davao, on Dec 11, 2008 07:54 AM, Report abuse Reply
kjksgauydgsgcdvljwthwebduysagas ghgx
by prasannabaishya, barpetaroad, on Dec 08, 2008 01:01 PM, Report abuse Reply
by petar, Sliven, on Dec 06, 2008 09:28 PM, Report abuse Reply
by bololo, ps, on Nov 27, 2008 09:35 PM, Report abuse Reply
Hi! Please could you send me a CD-Key for Devil May Cry 3 Special Edition fast.
by Johnny Storm, Kerala, on Nov 19, 2008 02:39 PM, Report abuse Reply
hi my name is khalid and i hope this site can give me the premetion to download devil may cry 3
by khalid, egypt, on Oct 30, 2008 01:11 AM, Report abuse Reply
ano po ung cd key ng devil may cry 3 sa pc ???
by Jehrees, Batangas, on Oct 22, 2008 04:13 PM, Report abuse Reply
by Michael, New York, on Oct 21, 2008 11:05 PM, Report abuse Reply
devil may cry 3 cd key... du67120631759495
by G@z@, Bangaluru, on Sep 15, 2008 01:12 AM, Report abuse Reply
by Abhijeet, Delhi, on Oct 18, 2008 08:09 PM, Report abuse
by islam, mansoura, on Oct 10, 2008 02:22 PM, Report abuse Reply
can you give me serial key of devil may cry3 special edition
by shubhankar arya, bareilly, on Sep 21, 2008 10:56 PM, Report abuse Reply
hai..frens...i cant play Rainbow vegas SIX 2,,it s go outta f frequency....m havin geforce 7300,can any1 help
by G@Z@, bengaluru, on Sep 15, 2008 01:20 AM, Report abuse Reply
by kavitha, chennai, on Sep 12, 2008 04:54 PM, Report abuse Reply
hi friends i have Devil May Cry 3: Special Edition D.V.D but i have not CD KEY plz give me CD KEY
by samir, gujarat, on Sep 09, 2008 10:37 AM, Report abuse Reply
by daxesh, ahmedabad, on Sep 08, 2008 07:38 PM, Report abuse Reply
hey i want to cd-key of Devil May Cry 3 fast
by daxesh, ahmedabad, on Sep 08, 2008 07:36 PM, Report abuse Reply
by priyanka, noida, on Dec 19, 2007 05:33 PM, Report abuse Reply
by ajit, c.h.d, on Aug 30, 2008 05:39 PM, Report abuse
some body help me i am searching for cd key of devil may cry 3....please help me
by chernouha othma, boumerdes-baghlia-ouled hmida, on Aug 27, 2008 11:09 PM, Report abuse Reply
thank you very much for cd key
by hellraiser, manhattan, on Aug 19, 2008 05:31 PM, Report abuse Reply
HAY MY NAME IS ENIS FROM BOSNIA AND HERCEGOVINA MOZES MI RECI STA TREBA POSLIJE INSTALACIJE IGRE PLEASEEEEE
by ENIS.GOLAC, GRADACAC, on Aug 25, 2008 02:57 PM, Report abuse
MOZETEL MI RECI STA TREBA POSLIJE INSTALACIJE IGRE
by ENIS.GOLAC, GRADACAC, on Aug 25, 2008 02:52 PM, Report abuse Reply
by ramu, hyderabad, on Aug 22, 2008 07:51 PM, Report abuse Reply
PC - Devil May Cry 3 Special Edition cd-key
by ashik, pune, on Aug 13, 2008 03:58 PM, Report abuse Reply
what is the cheat codes for PS 2 version
by kishore, chennai, on Aug 12, 2008 06:24 PM, Report abuse Reply
by kum, phimai, on Aug 07, 2008 04:21 PM, Report abuse Reply
by sareeshkumar.k, nileswar, on Aug 05, 2008 12:19 PM, Report abuse Reply
by Akash, delhi, on Aug 04, 2008 04:25 PM, Report abuse Reply
by Devil May Cry 3, Innsbruck, on Jul 29, 2008 11:17 AM, Report abuse Reply
cool game very interesting to play
by Micky Singh, Delhi, on Jul 22, 2008 07:58 AM, Report abuse Reply
by abhishek, maharashtra, on Jul 19, 2008 01:02 PM, Report abuse Reply
Hi I want to download this game Devil May Cry 3
by mudasir khan, bangalore, on Jul 08, 2008 11:25 AM, Report abuse Reply
by ashok, sarkaghat, on Jul 06, 2008 06:06 PM, Report abuse Reply
cant play devil may cry on my latest sony VAIO vista home edition ,pls someone help me
by jery, abuja, on Jun 27, 2008 04:55 PM, Report abuse Reply
by Sandeep, Bahthinda, on Jun 18, 2008 06:59 PM, Report abuse Reply
by arun, chennai, on Jun 16, 2008 09:04 AM, Report abuse Reply
by sreelatha, bangalore, on Jun 09, 2008 03:01 PM, Report abuse Reply
by chakrapani, Hyderabad, on Jun 01, 2008 12:39 PM, Report abuse Reply
by Sandip, Kolkata, on May 31, 2008 09:10 PM, Report abuse Reply
by ranjith, chennai, on May 21, 2008 12:58 PM, Report abuse Reply
by pravin, maharashtra, on May 03, 2008 10:42 AM, Report abuse Reply
by pavan, pune, on Apr 29, 2008 09:34 AM, Report abuse Reply
by masud, masud, on Apr 27, 2008 03:49 PM, Report abuse Reply
by krishnasagar, Visakhapatnam, on Apr 21, 2008 02:40 PM, Report abuse Reply
by Anonymous, iraq, on Apr 19, 2008 10:54 PM, Report abuse Reply
by cobra, varazdin, on Apr 15, 2008 05:36 PM, Report abuse Reply
Can you please tell me where I can get the Devil May Cry 3 crack from
by meme, Port Elizabeth, on Apr 13, 2008 06:33 AM, Report abuse Reply
by aadil, riyadh, on Apr 05, 2008 05:28 PM, Report abuse Reply
..............................................................
by aadil, riyadh, on Apr 05, 2008 05:25 PM, Report abuse Reply
by amoa, pune, on Mar 29, 2008 12:26 AM, Report abuse Reply
by amoa, pune, on Mar 29, 2008 12:20 AM, Report abuse Reply
by azz, cairo, on Mar 27, 2008 12:06 AM, Report abuse Reply
by azz, cairo, on Mar 27, 2008 12:02 AM, Report abuse Reply
PC - Devil May Cry 3 Special Edition cd-key
by Adam, polska, on Mar 24, 2008 04:32 PM, Report abuse Reply
by Rashid, raipur, on Mar 21, 2008 10:37 PM, Report abuse Reply
by saten, mustvee, on Mar 20, 2008 01:57 PM, Report abuse Reply
by Danna, Kuching, on Mar 18, 2008 12:28 PM, Report abuse Reply
by ajay, mumbai, on Mar 10, 2008 12:26 PM, Report abuse Reply
sd key for devil may cry 3 special eddition for pc is du67120633738128
by kapil jain, indore, on Mar 08, 2008 04:31 PM, Report abuse Reply
cd key for devil may cry3 special edition for pc
by meet choudhary, indore, on Mar 06, 2008 03:09 AM, Report abuse Reply
by jazy, new delhi, on Mar 05, 2008 05:36 PM, Report abuse Reply
by sree, hydarabad, on Mar 03, 2008 10:56 AM, Report abuse Reply
by girish makawana, ahmedabad, on Feb 19, 2008 08:33 PM, Report abuse Reply
by palanikumar, madurai, on Feb 18, 2008 05:44 PM, Report abuse Reply
by sameerjain, delhi, on Feb 16, 2008 09:21 AM, Report abuse Reply
by mmmm, tehran, on Feb 13, 2008 03:40 AM, Report abuse Reply
by sysys, sysys, on Jan 23, 2008 08:46 AM, Report abuse Reply
by dani, bucuresti, on Jan 18, 2008 03:53 PM, Report abuse Reply
by vondash, maynila, on Jan 13, 2008 03:38 PM, Report abuse Reply
aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
by sherif, alex, on Jan 08, 2008 02:14 AM, Report abuse Reply
i want to be able to play your games becose now i have registered
by godspower, warri, on Dec 30, 2007 10:19 PM, Report abuse Reply
i will kill for this game. where can i download pls
by locknum, cape town, on Dec 30, 2007 03:39 AM, Report abuse Reply
am enjoying your adverts if possible i want to get connected.
by chatramada Nath, nigeria, on Dec 18, 2007 06:08 PM, Report abuse Reply
by rajeev, bajbur, on Dec 17, 2007 10:44 AM, Report abuse Reply
by altayb, khartoum, on Dec 15, 2007 04:42 AM, Report abuse Reply
by Anonymous, delhi, on Dec 09, 2007 06:19 PM, Report abuse Reply
by kumar, madura, on Dec 05, 2007 12:24 PM, Report abuse Reply
by NAVEEN, INDIA, on Dec 03, 2007 05:27 PM, Report abuse Reply
by joanne, calamba, on Dec 03, 2007 03:49 PM, Report abuse Reply
by ritu, varanasi, on Dec 01, 2007 07:20 PM, Report abuse Reply
by bucgi, bucuresti, on Nov 26, 2007 02:04 AM, Report abuse Reply
this game is the most power full game and its rock yeah its super
by yazan, amman, on Sep 03, 2007 09:02 PM, Report abuse Reply
by arvind jora, delhi, on Nov 22, 2007 10:24 PM, Report abuse
by mohammed asif i, hyderabad, on Nov 11, 2007 12:09 PM, Report abuse Reply
provide me PC CD Keys of DEvil may cry 3 special Edition plz
by ashutosh, berhampur, on Nov 08, 2007 09:02 AM, Report abuse Reply
by fgfmhjkyuk, fefhjh, on Nov 04, 2007 03:53 PM, Report abuse Reply
by vital joaquim, sao paulo, on Nov 04, 2007 01:09 AM, Report abuse Reply
by parthasarathi p, bangalore, on Oct 24, 2007 08:36 AM, Report abuse Reply
by Shreya, Chennai, on Oct 14, 2007 09:16 AM, Report abuse Reply
by manoj, delhi, on Oct 11, 2007 02:42 PM, Report abuse Reply
by shyamraj bhat, pune, on Oct 08, 2007 10:24 AM, Report abuse Reply
by daneil, new york, on Sep 30, 2007 10:25 PM, Report abuse Reply
thanksfor providing the free games
by somnath behera, cuttack, on Dec 14, 2006 11:15 AM, Report abuse Reply
by jatin, rohini, on Jul 07, 2007 12:53 PM, Report abuse
by bijay agarwal, cuttack, on Sep 28, 2007 08:19 PM, Report abuse
I like to play games .It makes me to relakes
by Rinu, Chennai, on Sep 26, 2007 05:17 AM, Report abuse Reply
by vijay, pune, on Sep 22, 2007 10:16 AM, Report abuse Reply
by tushar, pune, on Sep 20, 2007 10:32 AM, Report abuse Reply
by john, grand-baie, on Sep 19, 2007 12:39 AM, Report abuse Reply
how could i download this game
by sachin, chandigarh, on Sep 14, 2007 11:10 AM, Report abuse Reply
i want to download devil may cry
by sa7tout, tetuan, on Sep 13, 2007 11:34 PM, Report abuse Reply
by bvchinna, rajahmundry, on Sep 03, 2007 08:20 PM, Report abuse Reply
by shad, iraq, on Aug 31, 2007 02:32 AM, Report abuse Reply
by esam, cairo, on Aug 30, 2007 03:28 AM, Report abuse Reply
by Marinko, Zrenjanin, on Aug 29, 2007 06:14 PM, Report abuse Reply
i need free java games in w810i model
by m.ramachnadran, chennai, on Aug 28, 2007 03:20 PM, Report abuse Reply
by gagan, Chandigarh, on Aug 27, 2007 06:32 PM, Report abuse Reply
by alen, zenica, on Aug 20, 2007 06:27 PM, Report abuse Reply
by kariss, rabat, on Aug 20, 2007 02:07 AM, Report abuse Reply
by mohammed, egypt, on Aug 17, 2007 01:55 PM, Report abuse Reply
by sagar, delhi, on Aug 17, 2007 11:42 AM, Report abuse Reply
by bharath, chennai, on Dec 08, 2006 04:10 PM, Report abuse Reply
Please give me the cheats of project IGI
by Amrit, Bhubaneswar, on Aug 12, 2007 02:47 PM, Report abuse
by anit, noida, on Aug 10, 2007 07:06 PM, Report abuse Reply
by sharad, pune, on Aug 08, 2007 09:03 AM, Report abuse Reply
by andrzejek, mielec, on Aug 03, 2007 02:06 AM, Report abuse Reply
my opinion is very good. nothing is in my mind. thanku.
by sabari raj, trivandrum, on Aug 02, 2007 03:19 PM, Report abuse Reply
will ths game work on windows vista
by kaushik, bangalore, on Jul 31, 2007 07:56 PM, Report abuse Reply
by Shivkumar, noida, on Jul 31, 2007 10:07 AM, Report abuse Reply
by rober, rg, on Jul 30, 2007 05:23 AM, Report abuse Reply
hello sir what is this plz explan me
by aijaz, hyderabad, on Jul 24, 2007 03:31 PM, Report abuse Reply
provide me PC CD Keys of DEvil may cry 3 special Edition
by arshad, mumbai-India, on Jul 23, 2007 08:10 AM, Report abuse Reply
by Aftab shaikh, ambernath (mumbai), on Jul 22, 2007 05:30 PM, Report abuse Reply
by viji, coimbatore, on Jan 07, 2007 06:23 AM, Report abuse Reply
by tridip, delhi, on Jul 14, 2007 01:08 PM, Report abuse
by Benzsample, thailand, on Jul 13, 2007 08:36 AM, Report abuse Reply
by Benzsample, thaiload, on Jul 13, 2007 08:32 AM, Report abuse Reply
by raj rio, hisar, on Jul 07, 2007 08:42 AM, Report abuse Reply
by subhash, mumbai, on Jul 06, 2007 05:59 PM, Report abuse Reply
by ganesh kumar, kvp, on Jul 06, 2007 02:40 PM, Report abuse Reply
by tridal, bharuch, on Jul 05, 2007 01:15 PM, Report abuse Reply
can i have the devil may cry thin demo
by damon, timins, on Jul 04, 2007 04:57 AM, Report abuse Reply
by damon, timins, on Jul 04, 2007 04:55 AM, Report abuse Reply
by mukesh, delhi, on Jul 02, 2007 05:04 PM, Report abuse Reply
i like and want to play devil may cry 3
by manav, rampur, on Jun 30, 2007 12:38 PM, Report abuse Reply
i want to play devil may cry 3
by manav, rampur, on Jun 30, 2007 12:34 PM, Report abuse Reply
by Pentax, dalat, on Jun 28, 2007 09:30 PM, Report abuse Reply
please i want to play this game and i want it cd key
by yugo, lagos, on Jun 27, 2007 01:39 AM, Report abuse Reply
by prem, pune, on Jun 23, 2007 04:01 PM, Report abuse Reply
by nemanja, belgrade, on Jun 20, 2007 08:56 PM, Report abuse Reply
by lucky, india, on Jun 18, 2007 02:56 PM, Report abuse Reply
by emma, london, on Jun 17, 2007 07:22 PM, Report abuse Reply
by dasdasd, dasdasd, on Jun 16, 2007 08:56 PM, Report abuse Reply
by siergejus, cork, on Jun 16, 2007 04:50 PM, Report abuse Reply
by anuj, allahabad, on Jun 15, 2007 06:34 PM, Report abuse Reply
by maruti naik, mumbai, on Jun 12, 2007 07:54 PM, Report abuse Reply
by chandu, mumbai, on Jun 09, 2007 03:59 PM, Report abuse Reply
by sumit, delhi, on Dec 16, 2006 05:29 PM, Report abuse Reply
i want download this game with its cd key please do that for me
by asif khan, PUNE, on Jun 07, 2007 01:55 PM, Report abuse
by rizwan, mumbai, on Jun 06, 2007 08:43 PM, Report abuse Reply
by mohammed, hyd, on Jun 04, 2007 08:19 PM, Report abuse Reply
by Anonymous, , on Jun 04, 2007 04:39 PM, Report abuse Reply
by Anonymous, rajkot, on Jun 03, 2007 11:57 PM, Report abuse Reply
by lili, delhi, on May 29, 2007 12:45 AM, Report abuse Reply
by sumit, kanpur, on May 28, 2007 01:12 PM, Report abuse Reply
by rehRHWRH, ERHrh, on May 27, 2007 07:34 PM, Report abuse Reply
by NAGARAJ, BANGALORE, on May 23, 2007 06:02 PM, Report abuse Reply
by arun kumar, chennai, on May 23, 2007 04:23 PM, Report abuse Reply
by Anonymous, THORNTON CO, on May 18, 2007 10:23 PM, Report abuse Reply
by sdfds, sdfsd, on May 10, 2007 11:57 PM, Report abuse Reply
by hari, coimbatore, on May 07, 2007 11:58 AM, Report abuse Reply
by manu, bangalore, on May 06, 2007 08:41 AM, Report abuse Reply
by vishnath pandit, delhi, on May 05, 2007 05:53 PM, Report abuse Reply
by vishnath, delhi, on May 05, 2007 05:51 PM, Report abuse Reply
by yash, delhi, on May 05, 2007 05:50 PM, Report abuse Reply
by akram, cairo, on May 05, 2007 12:52 AM, Report abuse Reply
by Bhavesh, Porbandar, on May 04, 2007 08:33 PM, Report abuse Reply
by anand, delhi, on May 04, 2007 08:22 PM, Report abuse Reply
by mukesh, delhi, on Apr 30, 2007 05:29 PM, Report abuse Reply
by deandb, Dobrich, on Apr 29, 2007 02:45 PM, Report abuse Reply
by dinesh, ludhiana, on Apr 25, 2007 03:12 PM, Report abuse Reply
by guyfuig, huohoh, on Apr 23, 2007 01:31 PM, Report abuse Reply
by ashish, pune, on Apr 22, 2007 05:28 PM, Report abuse Reply
by hyder, gurgaon, on Apr 13, 2007 01:59 PM, Report abuse Reply
by tamal biswas, kolkata, on Apr 02, 2007 01:00 PM, Report abuse Reply
by MASOUD, GONBAD, on Apr 12, 2007 12:25 AM, Report abuse
vai tomar no cuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu
by lucas kleaim, BAIXO GUADU, on Apr 11, 2007 06:23 PM, Report abuse Reply
by joca, subotica, on Apr 08, 2007 10:34 PM, Report abuse Reply
by nhed, manila, on Apr 05, 2007 03:29 PM, Report abuse Reply
by 54546, 45y4, on Apr 04, 2007 04:56 PM, Report abuse Reply
by pra_pri, ahmedabad, on Apr 04, 2007 12:07 AM, Report abuse Reply
by pra_pri, ahmedabad, on Apr 04, 2007 12:10 AM, Report abuse
i have been w8ng for this game goto to go and check out this version
by subbu, bangalore, on Apr 03, 2007 04:47 PM, Report abuse Reply
by Hanther, India, on Mar 30, 2007 08:30 PM, Report abuse Reply
by kishore kumar, vizag, on Jan 13, 2007 07:27 PM, Report abuse Reply
you have the cd key of devil me cry
by Sheila, Iligan, on Mar 27, 2007 07:43 AM, Report abuse
i need cd key of devil me cry pls send me....
by Sheila, Iligan, on Mar 27, 2007 07:41 AM, Report abuse Reply
I need athe cd key, anybody can help me?
by Sheila, Phil, on Mar 24, 2007 01:36 PM, Report abuse Reply
by harry, kurukshetra, on Mar 24, 2007 09:55 AM, Report abuse Reply
can i download devil may cry 3 to pc (free) give me the link pls.
by s0nny_2oo4, tembilahan, on Mar 21, 2007 09:28 AM, Report abuse Reply
by prabodh, kolkata, india, on Jan 21, 2007 02:10 PM, Report abuse Reply
by sam, tyty, on Mar 20, 2007 06:05 PM, Report abuse
by Anonymous, , on Mar 11, 2007 08:52 PM, Report abuse Reply
by dfer, kochi, on Mar 10, 2007 11:56 AM, Report abuse Reply
by vinod, mumbai, on Feb 27, 2007 07:18 PM, Report abuse Reply
by mayur, mumbai, on Feb 25, 2007 03:49 PM, Report abuse Reply
by anonymous, anonymous, on Feb 23, 2007 08:52 PM, Report abuse Reply
by ROCKY, RANCHI, on Feb 21, 2007 06:57 PM, Report abuse Reply
If you wish to notify the moderator that this particular message contains spam or other offensive content, simply hit the "Submit" button (there is no need to enter a comment). If you wish to make a comment about this post to the moderator, then feel free to enter something into the comment field below.
by bhupendra, mpdinagar, on Feb 21, 2007 08:30 AM, Report abuse Reply
by dfsdf, sdfsdf, on Feb 15, 2007 08:49 PM, Report abuse Reply
If you wish to notify the moderator that this particular message contains spam or other offensive content, simply hit the "Submit" button (there is no need to enter a comment). If you wish to make a comment about this post to the moderator, then feel free to enter something into the comment field below.
by sandeep, surat, on Feb 15, 2007 11:50 AM, Report abuse Reply
by mohsen, boshehr, on Feb 10, 2007 01:16 AM, Report abuse Reply
by syed, channai, on Feb 02, 2007 06:05 PM, Report abuse Reply
by syed, channai, on Feb 02, 2007 06:00 PM, Report abuse Reply
by shivam jalkote, amravati, on Feb 01, 2007 06:31 PM, Report abuse Reply
I NEVER BEEN PLAYED IT. SO I CANT TO TELL ABOUT THIS GAME. IF YOU PROVIDE ME A DEMO VERSION THEN I CAN GIVE MY OPENION.
by Kalyan Mazumder, Kolkata, on Sep 06, 2006 01:23 AM, Report abuse Reply
i want to play a demo version,and then i can give my openion.
by abhimannyu, Chennai, on Jan 21, 2007 08:14 PM, Report abuse
people i really need the cd key for this game!
by angie, buenos aires, on Jan 20, 2007 05:24 AM, Report abuse Reply
i need a cd-key pleaseeeee now please
by george, haskovo, on Jan 20, 2007 04:26 AM, Report abuse Reply
by gunashekar, bangalore, on Jan 17, 2007 10:45 AM, Report abuse Reply
i need a cd key for this game please!
by kyle, red deer, on Jan 10, 2007 05:09 AM, Report abuse Reply
by AHSANKHAN, HYDERABAD, on Jan 09, 2007 01:56 PM, Report abuse Reply
by Sandeep kumar, Panchkula, on Jan 08, 2007 02:53 PM, Report abuse Reply
by KUMARA, CHENNAI, on Jan 08, 2007 12:32 AM, Report abuse Reply
by ngbf, bnvnmb, on Jan 07, 2007 12:39 PM, Report abuse Reply
I want the save game for my pc adn the cheats.
by khashayar, tehran, on Jan 07, 2007 07:42 PM, Report abuse
by Ashok kumar, Punchkula, on Jan 06, 2007 03:37 PM, Report abuse Reply
by taran, nagpur, on Jan 05, 2007 08:22 PM, Report abuse Reply
why u are not downloading those games to us.
by bereket, OROMIYA, on Jan 01, 2007 02:03 PM, Report abuse Reply
by kabir, mumbai, on Jan 01, 2007 01:07 PM, Report abuse Reply
by ramesh, bangalore, on Dec 28, 2006 06:25 PM, Report abuse Reply
by jayant, new delhi, on Dec 23, 2006 12:23 PM, Report abuse Reply
by kunal, bombay, on Dec 20, 2006 09:35 AM, Report abuse Reply
by gurdeep, jammu, on Dec 16, 2006 04:47 PM, Report abuse Reply
by sivakumar, chennai, on Dec 14, 2006 04:12 PM, Report abuse Reply
by sivakumar, chennai, on Dec 14, 2006 04:11 PM, Report abuse Reply
by aijaz, hyderabad, on Dec 11, 2006 01:09 PM, Report abuse Reply
frst of all play demo i sure u will go for it for full
by shaky_143, Ludhiana, on Dec 08, 2006 04:21 PM, Report abuse Reply
by bharath, chennai, on Dec 08, 2006 04:08 PM, Report abuse Reply
by Bhanu Pratap Si, Delhi, on Dec 04, 2006 01:17 PM, Report abuse Reply
its pretty fun ive beaten it on hardnormal ndcurently working on very hard mode with sparde costume as sonte
by devilmaycrybomn, graham, on Dec 05, 2006 11:26 PM, Report abuse
by Vjy, Ahmedabad / India, on Dec 05, 2006 10:44 AM, Report abuse Reply
by bereket, Haramaya University(Oromia), on Nov 13, 2006 01:03 PM, Report abuse Reply
by Bhanu Pratap Si, Delhi, on Dec 04, 2006 01:19 PM, Report abuse
by KULDEEP, NOIDA, on Dec 04, 2006 10:50 AM, Report abuse Reply
by harry, chandigarh, on Dec 03, 2006 12:50 PM, Report abuse Reply
by SWAPNIL, MUMBAI, on Nov 09, 2006 10:36 AM, Report abuse Reply
by avdhesh, delhi, on Nov 02, 2006 10:54 PM, Report abuse Reply
by naveen, hyderabad, on Nov 02, 2006 08:16 PM, Report abuse Reply
by R.S.priya, madurai, on Oct 30, 2006 11:57 PM, Report abuse Reply
by ahmed, cairo, on Oct 10, 2006 09:34 PM, Report abuse Reply
by RAJA, COIMBATORE, on Oct 10, 2006 06:46 PM, Report abuse Reply
by Giang, Hanoi, on Oct 06, 2006 03:02 PM, Report abuse Reply
by aleempasha, Bangalore, on Sep 03, 2006 06:57 PM, Report abuse Reply
by guna, chennai, on Sep 21, 2006 08:33 PM, Report abuse
by SHANTALING, BANGALORE, on Sep 03, 2006 10:33 PM, Report abuse Reply
by guna, chennai, on Sep 21, 2006 08:32 PM, Report abuse
by parveen verma, kaithal, on Sep 11, 2006 10:39 PM, Report abuse Reply
by guna, chennai, on Sep 21, 2006 08:31 PM, Report abuse
by karthik, chennai, on Sep 18, 2006 09:12 AM, Report abuse Reply
by guna, chennai, on Sep 21, 2006 08:29 PM, Report abuse
Can u send me a game of 'JONE OF ARC"
by Sam, Mum, on Sep 03, 2006 11:46 PM, Report abuse Reply
Thanks for providing free games
by aleempasha, Bangalore, on Sep 03, 2006 06:56 PM, Report abuse Reply
by kumar, landan, on Sep 02, 2006 02:01 PM, Report abuse Reply
by nikhil, mumbai, on Sep 02, 2006 12:40 PM, Report abuse Reply
Home | Products | News | Reviews | User Reviews | Games | Downloads | Guides | Forums | Comments | Price Search | eClassifieds | Ask TechTree | Contests
Feedback | Sales Offices | Contact Us | Disclaimer
Copyright(C) 2009 UNML. All rights reserved.
Can I have a free version of the game? Thanks. If there is a cd key require to play the game, can I have it =]
by Jason, fremont, on Apr 08, 2007 11:08 AM, Report abuse Reply